File:Figure3bN.png
From Wikimedia Commons
Jump to navigation
Jump to search
Size of this preview: 800 × 600 pixels. Other resolutions: 320 × 240 pixels | 640 × 480 pixels | 960 × 720 pixels.
Original file (960 × 720 pixels, file size: 394 KB, MIME type: image/png)
File information
Structured data
Captions
Summary
[edit]DescriptionFigure3bN.png |
English: Three G-quadruplexes stack to form four stranded telomere with different topologies for d(GGGATTGGGATTGGGATTGGG) sequence. |
Date | |
Source | Own work |
Author | Bhattasinp |
Licensing
[edit]I, the copyright holder of this work, hereby publish it under the following license:
This file is licensed under the Creative Commons Attribution-Share Alike 4.0 International license.
- You are free:
- to share – to copy, distribute and transmit the work
- to remix – to adapt the work
- Under the following conditions:
- attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.
- share alike – If you remix, transform, or build upon the material, you must distribute your contributions under the same or compatible license as the original.
File history
Click on a date/time to view the file as it appeared at that time.
Date/Time | Thumbnail | Dimensions | User | Comment | |
---|---|---|---|---|---|
current | 06:18, 26 December 2019 | 960 × 720 (394 KB) | Bhattasinp (talk | contribs) | Cross-wiki upload from en.wikiversity.org |
You cannot overwrite this file.
File usage
There are no pages that use this file.
Global file usage
The following other wikis use this file:
- Usage on en.wikipedia.org
- Usage on en.wikiversity.org
- Usage on zh.wikiversity.org
Metadata
This file contains additional information, probably added from the digital camera or scanner used to create or digitize it.
If the file has been modified from its original state, some details may not fully reflect the modified file.
Horizontal resolution | 37.8 dpc |
---|---|
Vertical resolution | 37.8 dpc |
Software used |
|
Structured data
Items portrayed in this file
depicts
Some value without a Wikidata item
12 December 2019
image/png
Hidden categories: